Completely unbiased auxlang

[Fanael]

I made a completely unbiased auxlang. Here's everything you could possibly want to know about it:

---

What's your opinion? Is there any bias I've missed?

[Dezinaa]

Edit: Sorry if I sounded like a jerk, I thought this was a joke.

[Squall]

Maybe that is the result of an auxlang after removing features that are difficult for most people.


But I think that an attempt is still valid.
Chinese lacks /r/ and Japanese lacks /l/. If the auxlang had /ɺ/ without /l r/, the learners would use /r/ or /l/ without conflicting phonemes.
I think a vowel inventory containing /a ə i u/ or /a e̞ i o̞ u/ is good. People that cannot say /e̞/ could use /e/ or /ɛ/ without being misinterpreted.

The consonants /p t k m n f s h~x ɺ~r~l tʃ/ seem easy for most people.

[Fanael]

This seems a little too complicated. Auxlangs need to be as simple as possible. Otherwise they would be impossible to learn.

That's right, but you can't have everything. I don't see a way to reduce the complexity without the language losing its neutrality.

If the auxlang had /ɺ/ without /l r/, the learners would use /r/ or /l/ without conflicting phonemes.

I always found this argument rather weak. I can imagine that being a problem for learners whose L1 distinguishes /r/ and /l/, who'd be looking for a distinction that isn't there.

The consonants /p t k m n f s h~x ɺ~r~l tʃ/ seem easy for most people.

One of the languages I'm learning doesn't have anything remotely close to /tʃ/: /t/? /s/? They're not very [tʃ]-like.

[CMunk]

So a phonology consisting of:
/m n/
/p t k/
/s ɸ~f~h/
/l~r/
/j v~ʋ~w/

/i u/
/ə/ (this would have a lot of allophones ranging from [y] to [ɔ])
/a/

(C)V syllable structure

And I suppose an isolating grammar with no mandatory markings.

[Creyeditor]

But /p/ vs /f/ is so difficult for many people, e.g. Indonesians And some of them also can't produce /h/ ...

[Lao Kou]

But /p/ vs /f/ is so difficult for many people, e.g. Indonesians And some of them also can't produce /h/ ...

And /n/ vs. /l/ is so difficult for many people across the Chinese language spectrum. That gives us:

/m n~l~r/
/p~ɸ~f~h t k/
/s/
/j v~ʋ~w/

/i u/
/ə/ (not an English bias? )
/a/

(C)V syllable structure

Getting closer to:

---

without even leaving phonology.

[cntrational]

Uh, all I see is a line.

[DesEsseintes]

Uh, all I see is a line.

I believe that's the point.

Spoiler:

Does that sound like a weird Maths joke to anyone other than me?

[cntrational]

Oh ho.

[Creyeditor]

Did we forgot 'em poor Hawai'ians? No /t/ vs. /k/
And isn't it difficult to pronounce a Schwa for some Italian and Spanish people?

/m n~l~r/
/p~ɸ~f~h t~k/
/s/
/j v~ʋ~w/

/i u/
/a/

[Squall]

We do not need to have phonemes present in all languages. We need phonemes that can be learned by listening to it only once and do not require much effort to pronounce if one is not used to it.

/i u/
/ə/ (not an English bias? )
/a/

No, because it includes /a/ and the English speakers will have to choose between /æ/ and /ɒ/.

And isn't it difficult to pronounce a Schwa for some Italian and Spanish people?

They can use /e/ or /o/, because there are no conflicting phonemes.

[Creyeditor]

We do not need to have phonemes present in all languages. We need phonemes that can be learned by listening to it only once and do not require much effort to pronounce if one is not used to it.

That's what I meant when I mentioned the /p/ vs. /f/, the /h/ and the /t/ vs. /k/ thing. These are not easy to learn by listening to it only once for speakers of Indonesian, French, etc..

And isn't it difficult to pronounce a Schwa for some Italian and Spanish people?

They can use /e/ or /o/, because there are no conflicting phonemes.

But spanish /e/ and /o/ sound like /i/ and /u/ to some people, e.g. some Arabic speakers.

[Squall]

If the speakers of each language had to learn at most only one foreign phoneme?

[Lao Kou]

/m n~l~r/
/p~ɸ~f~h t~k/
/s/
/j v~ʋ~w/

/i u/
/a/

That's the spirit! Gettin' closer...

[QuantumWraith]

Let's not forget about Australian Aboriginal languages with no fricatives, or the various languages without distinctive nasals... or those without labial obstruents... Oh, and I believe some languages, like Arrernte, are said to only contrast /ə a/.

/l~r/
/t~k/
/j w/

/a/

...we there yet?

[Lao Kou]

/l~r/
/t~k/
/j w/

/a/

...we there yet?

[Znex]

Let's not forget about Australian Aboriginal languages with no fricatives, or the various languages without distinctive nasals... or those without labial obstruents... Oh, and I believe some languages, like Arrernte, are said to only contrast /ə a/.

/l~r/
/t~k/
/j w/

/a/

...we there yet?

You know, we might as well just make a language based off DNA, then it is also unbiased towards people who can speak as opposed to those who can't.

GCTAGTGATTTAGCTGATCGCCCTAGCTGATCGATGCTGTTGATGCTTAATCGAAAATGCTCGCTGTTGCTGCTGATAAATGCTAG
TCGTGATGAATGCTGATGCTGATGATGGCTGATGTCCTGATAGTCGATGTTGATGCTGATAGCTGATGCTGATCGAATGCTGATAGT
CCCTGATGCTAGATTTGCTGATCGTTAGTCGATGATGATGCTGTGGTCGAGTGCT.

[Mugitus]

I feel as if this phonology has some difficult sounds for speakers of languages like Pirahã and Rotokas, thus I propose this inventory for the auxlang:

/t~k/

/a/

Distinguishing words may be difficult...

Sample sentence:

Ta taka ka ta kata takaka!

[Xing]

It reminds me of my own auxlang, which I need to spend some time on.